Bemærk Denne artikel blev udgivet for over en måned siden

Nej, amerikansk professor har ikke sagt, at covid-19 ikke findes

Faktatjek 9. mar 2021  -  5 min læsetid
This describes the image
En lang række facebookopslag hævder, at en amerikansk professor har udmeldt, at covid-19 slet ikke findes. Men professoren afviser selv, at han står bag budskaberne i opslagene. Foto: Philip Davali-Ritzau Scanpix
  • En amerikansk professor har meldt ud, at covid-19 slet ikke findes, hævder en lang række opslag på sociale medier

  • Det skulle professoren have gjort efter at have undersøgt 1.500 angiveligt positive coronaprøver uden at finde en eneste med SARS-CoV-2 i. I stedet fandt han influenza A og B, påstås det i opslagene

  • Det påstås desuden, at det aldrig endegyldigt er påvist, at SARS-CoV-2 findes

  • Men professoren afviser, at han står bag budskaberne i opslagene

  • Og der er masser af beviser for, at SARS-CoV-2 er ganske virkelig

Covid-19 eksisterer ikke, og hele pandemien er et stort svindelnummer.

Det skulle den amerikanske professor Robert Oswald fra Cornell University angiveligt have udmeldt. I hvert fald hvis man skal tro en række enslydende opslag i form af et kædebrev, der lige nu florerer på Facebook.

Opslagene har også tidligere optrådt engelsk og er delt i flere lande, herunder USA, Tyskland, Tjekkiet og Portugal.

Ifølge opslagene skulle professoren have undersøgt 1.500 positive prøver for SARS-CoV-2, der som bekendt kan give sygdommen covid-19. Men selv om prøverne angiveligt var positive fandt professoren ingen spor af den berygtede virus i dem, beretter opslagene. I stedet fandt han influenza A og B. Og det får ifølge opslagene professoren til at konkludere, at covid-19 slet ikke findes.

Derudover har ingen haft succes med at rense og isolere prøverne og på den måde endegyldigt påvise, at covid-19 findes, står der i opslagene.

Men Robert Oswald afviser selv, at han skulle have påstået, at SARS-CoV-2 ikke findes. Desuden findes der flere beviser for, at virussen er ganske virkelig.

This describes the image
En lang række enslydende opslag som dette florerer lige nu på Facebook. I opslagene hævdes det, at en amerikansk professor har udmeldt, at covid-19 slet ikke findes. Men den amerikanske afviser selv, at han står bag budskaberne. Foto: Skærmbillede af Facebook

Professor afviser

Robert Oswald er professor ved Cornell University, hvor han forsker i molekylær medicin, men professoren står ikke bag påstandene i de mange facebookopslag. 

Det fremgår af en meddelelse som Robert Oswald har lagt ud på sin forskerprofil på universitetets hjemmeside, efter de mange facebookopslag om ham begyndte at florere.

“Covid-19 er ægte. Ethvert facebookopslag, der påstår andet, er fup og er ikke sandt. Brug mundbind, hold afstand og få vaccinen, når den bliver tilgængelig,” skriver professoren i meddelelsen.

Robert Oswald har udtalt til andre medier, at han ikke står bag opslaget, og at dets indhold desuden er forkert. 

“Virussen er utrolig velstuderet med mange helgenomsekvenser fra patienter,” siger han eksempelvis til det amerikanske faktatjekmedie Snopes.

Både renset og isoleret

Når Robert Oswald taler om helgenomsekventering af virussen, henviser han til den proces, der finder sted, når man finder virussens genetiske kode. Netop helgenomsekventering er en af flere måder, hvorpå man kan påvise virussens eksistens.

TjekDet har tidligere faktatjekket påstande om, at ny coronavirus slet ikke findes. Også dengang var svaret klart. Virussen eksisterer, og forskere og sundhedsmyndigheder har endda dokumenteret det på flere måder.

Ved hjælp af helgenomsekventering er virussens unikke kode kortlagt. Koden er lang og består af fire forskellige bogstaver, der hver især repræsenterer en af fire nukleinsyrer: adenin, cytosin, guanin og urasil.

Sammensætningen af de fire nukleinsyrer udgør virussens unikke arvemateriale bestående af den genetiske kode. Mens menneskers arvemateriale består af DNA, består virussers arvemateriale af RNA. Virussens genetiske kode kan sammenlignes med et unikt fingeraftryk, der gør, at den ikke kan forveksles med andre virusser som eksempelvis influenza A og B, som det ellers beskrives i facebookopslagene.

Uddrag af den genetiske kode for SARS-CoV-2

auuaaagguuuauaccuucc   cagguaacaaaccaaccaac   uuucgaucucuuguagaucu
guucucuaaacgaacuuuaa   aaucuguguggcugucacuc   ggcugcaugcuuagugcacu
cacgcaguauaauuaauaac   uaauuacugucguugacagg   acacgaguaacucgucuauc
uucugcaggcugcuuacggu   uucguccguguugcagccga   ucaucagcacaucuagguuu
cguccgggugugaccgaaag   guaag


Det er også den genetiske kode, forskere undersøger i laboratoriet, når de skal finde ud af, om en virus er ny eller allerede kendt, har Christian Wejse tidligere fortalt TjekDet. Han er lektor i infektionssygdomme og folkesundhed ved Aarhus Universitet og afdelingslæge på Aarhus Universitetshospital.

“Man aflæser hver enkelt nukleinsyre i virussen, som forkortes A, C, G og U, og deres rækkefølge giver den samlede kode. Den kode kan man så sammenligne med andre kendte virusser for at se, om der er sammenfald. For SARS-CoV-2 var der ingen sammenfald, selvom den mindede en del om SARS-CoV-1. Derfor fik den det navn,” siger han.

Ifølge facebookopslagene har ingen endnu haft succes med at oprense og isolere virussen. Og derfor kan man ikke entydigt bekræfte, at den findes, hævder opslagene.

Men når man helgenomsekventerer, isolerer man netop virus, fortæller Morten Agertoug Nielsen, der er lektor i parasitologi ved Københavns Universitet.

"Man laver simpelthen et skrab fra en slimhinde, hvor virus ofte sidder og måler på den genetiske sekvens, og hvis der er den bestemte sekvens, så er det, fordi der er virus i prøven. På den måde kan man isolere og identificere virus," siger han.

Og SARS-CoV-2 er faktisk blevet isoleret ganske mange gange, forklarer han. For hver gang man udfører en af de PCR-tests, der lige nu anvendes over hele verden, isolerer man i virkeligheden en del af virussen.

"Ved PCR-test går man ind med nogle specifikke prober, som kun binder til virus-RNA, og måler om der er virus-RNA til stede," siger Morten Agertoug Nielsen.

Flere beviser

At en virus findes kan også påvises ved at dyrke den. Det gør man ved at tilsætte virussen til en cellekultur i en plastikskål, der indeholder en gel bestående af en række ingredienser, som giver virussen gode muligheder for at vokse.

“Det kunne være blod, sukker, kulhydrater og den slags næringsstoffer, som virus skal bruge for at kunne kopiere sig selv i cellerne. Skaffer man de betingelser, så kan man dyrke virussen uden for menneskekroppen, så den kommer til at se ud på en måde, der er karakteristisk for lige netop den type virus,” siger Christian Wejse.

På den måde kan man undersøge virussens biologi og opførsel inde i cellen. Det giver blandt andet mulighed for at udforske virussen med henblik på at udvikle medicin mod den.

Til sidst kan man se virussen ved hjælp af et særligt mikroskop kaldet et elektronmikroskop. Det gør det muligt at se både celler, bakterier og virus. Det er også ved hjælp af sådan et mikroskop af de nedenstående billeder af SARS-CoV-2-virussen er taget.

This describes the image
Ved hjælp af mikroskoper har man været i stand til at fotografere SARS-CoV-2-virussen. Disse fotografier er farvelagt for at fremhæve virussen. Foto: Foto: National Institute of Allergy and Infectious Diseases
Opdateret 8. nov 2021